
In order to export alignment results or clones from a binary file (.vdjca or .clns) to a human-readable text file one can use the exportAlignments and exportClones commands respectively. The syntax for these commands is:

# export alignments from .vdjca file
mixcr exportAlignments [options] alignments.vdjca alignments.txt
# export alignments from .clna file
mixcr exportAlignments [options] clonesAndAlignments.clna alignments.txt
# export clones from .clns file
mixcr exportClones [options] clones.clns clones.txt

# export clones from .clna file
mixcr exportClones [options] clonesAndAlignments.clna clones.txt

The resulting tab-delimited text file will contain columns with different types of information. If no options are specified, the default set of columns - which is sufficient in most cases - will be exported. The possible columns include (see below for details): aligned sequences, qualities, all or just best hit for V, D, J and C genes, corresponding alignments, nucleotide and amino acid sequences of gene region present in sequence, etc. When exporting clones, the additional columns include: clone count, clone fraction etc.

One can customize the list of fields that will be exported by passing parameters to export commands. For example, in order to export just clone count, best hits for V and J genes with corresponding alignments and CDR3 amino acid sequence, one can do:

mixcr exportClones -count -vHit -jHit -vAlignment -jAlignment -aaFeature CDR3 clones.clns clones.txt

The columns in the resulting file will be exported in exactly the same order as parameters on the command line. The list of available fields will be reviewed in the next subsections. For convenience, MiXCR provides two predefined sets of fields for exporting: min (will export minimal required information about clones or alignments) and full (used by default); one can use these sets by specifying the --preset option:

mixcr exportClones --preset min clones.clns clones.txt

One can add additional columns to the preset in the following way:

mixcr exportClones --preset min -qFeature CDR2 clones.clns clones.txt

One can also put all specify export fields in a separate file:

-feature CDR3

and pass this file to the export command:

mixcr exportClones --preset-file myFields.txt clones.clns clones.txt

To get command line help on export action one can use

mixcr help exportAlignments
mixcr help exportClones

Command line parameters

The following is a list of command line parameters for both exportAlignments and exportClones:

Option Description
-c, --chains Limit output to specific chain(s) (e.g. TRA or IGH). When using with exportClones, clone fractions will be recalculated accordingly.
-p, --preset Select a predefined set of fields to export (full, min, fullImputed and minImputed, the last two use -nFeatureImputed and -aaFeatureImputed instead of -nFeature and -aaFeature; this will use germline sequences (marked lowercase) for unaligned regions.)
-pf, --preset-file Load a file with a list of fields to export
-v, --with-spaces Output in more human-readable format.
-n, --limit Output only first n records.

The following parameters only apply to exportClones:

-o, --filter-out-of-frames Exclude out of frames (fractions will be recalculated)
-t, --filter-stops Exclude sequences containing stop codons (fractions will be recalculated)
-m, --minimal-clone-count Filter clones by minimal read count.
-q, --minimal-clone-fraction Filter clones by minimal clone fraction.

Available fields

The following fields can be exported both for alignments and clones:

Field name Description
-targets Number of targets
-vHit Best V hit
-dHit Best D hit
-jHit Best J hit
-cHit Best C hit
-vGene Best V hit gene name (e.g. TRBV12-3 for TRBV12-3*00)
-dGene Best D hit gene name (e.g. TRBV12-3 for TRBV12-3*00)
-jGene Best J hit gene name (e.g. TRBV12-3 for TRBV12-3*00)
-cGene Best C hit gene name (e.g. TRBV12-3 for TRBV12-3*00)
-vFamily Best V hit family name (e.g. TRBV12 for TRBV12-3*00)
-dFamily Best D hit family name (e.g. TRBV12 for TRBV12-3*00)
-jFamily Best J hit family name (e.g. TRBV12 for TRBV12-3*00)
-cFamily Best C hit family name (e.g. TRBV12 for TRBV12-3*00)
-vHitScore Score for best V hit
-dHitScore Score for best D hit
-jHitScore Score for best J hit
-cHitScore Score for best C hit
-vHitsWithScore All V hits with score
-dHitsWithScore All D hits with score
-jHitsWithScore All J hits with score
-cHitsWithScore All C hits with score
-vHits All V hits
-dHits All D hits
-jHits All J hits
-cHits All C hits
-vGenes All V gene names (e.g. TRBV12-3 for TRBV12-3*00)
-dGenes All D gene names (e.g. TRBV12-3 for TRBV12-3*00)
-jGenes All J gene names (e.g. TRBV12-3 for TRBV12-3*00)
-cGenes All C gene names (e.g. TRBV12-3 for TRBV12-3*00)
-vFamilies All V gene family anmes (e.g. TRBV12 for TRBV12-3*00)
-dFamilies All D gene family anmes (e.g. TRBV12 for TRBV12-3*00)
-jFamilies All J gene family anmes (e.g. TRBV12 for TRBV12-3*00)
-cFamilies All C gene family anmes (e.g. TRBV12 for TRBV12-3*00)
-vAlignment Best V alignment
-dAlignment Best D alignment
-jAlignment Best J alignment
-cAlignment Best C alignment
-vAlignments All V alignments
-dAlignments All D alignments
-jAlignments All J alignments
-cAlignments All C alignments
-nFeature <gene_feature> Nucleotide sequence of specified gene feature
-qFeature <gene_feature> Quality string of specified gene feature
-aaFeature <gene_feature> Amino acid sequence of specified gene feature
-nFeatureImputed <gene_feature> Nucleotide sequence of specified gene feature using letters from germline (marked lowercase) for unaligned regions
-aaFeatureImputed <gene_feature> Amino acid sequence of specified gene feature using letters from germline (marked lowercase) for unaligned regions
-minFeatureQuality <gene_feature> Minimal quality of specified gene feature
-avrgFeatureQuality <gene_feature> Average quality of specified gene feature
-lengthOf <gene_feature> Length of specified gene feature.
-nMutations <gene_feature> Extract nucleotide mutations for specific gene feature; relative to germline sequence.
-nMutationsRelative <gene_feature> <relative_to_gene_feature> Extract nucleotide mutations for specific gene feature relative to another feature.
-aaMutations <gene_feature> Extract amino acid mutations for specific gene feature
-aaMutationsRelative <gene_feature> <relative_to_gene_feature> Extract amino acid mutations for specific gene feature relative to another feature.
-mutationsDetailed <gene_feature> Detailed list of nucleotide and corresponding amino acid mutations. Format <nt_mutation>:<aa_mutation_individual>:<aa_mutation_cumulative>, where <aa_mutation_individual> is an expected amino acid mutation given no other mutations have occurred, and <aa_mutation_cumulative> amino acid mutation is the observed amino acid mutation combining effect from all other. WARNING: format may change in following versions.
-mutationsDetailedRelative <gene_feature> <relative_to_gene_feature> Detailed list of nucleotide and corresponding amino acid mutations written, positions relative to specified gene feature. Format <nt_mutation>:<aa_mutation_individual>:<aa_mutation_cumulative>, where <aa_mutation_individual> is an expected amino acid mutation given no other mutations have occurred, and <aa_mutation_cumulative> amino acid mutation is the observed amino acid mutation combining effect from all other. WARNING: format may change in following versions.
-positionInReferenceOf <reference_point> Position of specified reference point inside referencesequences (clonal sequence / read sequence).
-positionOf <reference_point> Position of specified reference point inside targetsequences (clonal sequence / read sequence).
-defaultAnchorPoints Outputs a list of default reference points (like CDR2Begin, FR4End, etc. see documentation for the full list and formatting)
-vIdentityPercents V alignment identity percents
-dIdentityPercents D alignment identity percents
-jIdentityPercents J alignment identity percents
-cIdentityPercents C alignment identity percents
-vBestIdentityPercent V best alignment identity percent
-dBestIdentityPercent D best alignment identity percent
-jBestIdentityPercent J best alignment identity percent
-cBestIdentityPercent C best alignment identity percent
-chains Chains
-topChains Top chains

The following fields are specific for alignments:

Field name Description
-readId Id of read corresponding to alignment (deprecated)
-readIds Id(s) of read(s) corresponding to alignment
-sequence Aligned sequence (initial read), or 2 sequences in case of paired-end reads
-quality Initial read quality, or 2 qualities in case of paired-end reads
-descrR1 Description line from initial .fasta or .fastq file (deprecated)
-descrR2 Description line from initial .fasta or .fastq file (deprecated)
-descrsR1 Description lines from initial .fasta or .fastq file for R1 reads (only available if -OsaveOriginalReads=true was used in align command)
-descrsR2 Description lines from initial .fastq file for R2 reads (only available if -OsaveOriginalReads=true was used in align command)
-readHistory Read history
-cloneId To which clone alignment was attached (make sure using .clna file as input for exportAlignments)
-cloneIdWithMappingType To which clone alignment was attached with additional info on mapping type (make sure using .clna file as input for exportAlignments)

The following fields are specific for clones:

Field name Description
-cloneId Unique clone identifier
-count Clone count
-fraction Clone fraction
-sequence Aligned sequence (initial read), or 2 sequences in case of paired-end reads
-quality Initial read quality, or 2 qualities in case of paired-end reads

See this chapter for the translation rules used for options like: -aaFeature.

Default anchor point positions

Positions of anchor points produced by the -defaultAnchorPoints option are outputted as a colon separated list. If an anchor point is not covered by the target sequence nothing is printed for it, but flanking colon symbols are preserved to maintain positions in array. See example:


If there are several target sequences (e.g. paired-end reads or multi-part clonal sequnce), an array is outputted for each target sequence. In this case arrays are separated by a comma:


Even if there are no anchor points in one of the parts:


The following table shows the correspondence between anchor points and positions in the default anchor point array:

Anchors point Zero-based position One-based position
V5UTRBeginTrimmed 0 1
V5UTREnd / L1Begin 1 2
L1End / VIntronBegin 2 3
VIntronEnd / L2Begin 3 4
L2End / FR1Begin 4 5
FR1End / CDR1Begin 5 6
CDR1End / FR2Begin 6 7
FR2End / CDR2Begin 7 8
CDR2End / FR3Begin 8 9
FR3End / CDR3Begin 9 10
Number of 3’ V deletions (negative value), or length of 3’ V P-segment (positive value) 10 11
VEndTrimmed, next position after last aligned nucleotide of V gene 11 12
DBeginTrimmed, position of first aligned nucleotide of D gene 12 13
Number of 5’ D deletions (negative value), or length of 5’ D P-segment (positive value) 13 14
Number of 3’ D deletions (negative value), or length of 3’ D P-segment (positive value) 14 15
DEndTrimmed, next position after last aligned nucleotide of D gene 15 16
JBeginTrimmed, position of first aligned nucleotide of J gene 16 17
Number of 3’ J deletions (negative value), or length of 3’ J P-segment (positive value) 17 18
CDR3End / FR4Begin 18 19
FR4End 19 20
CBegin 20 21
CExon1End 21 22

The following regular expressions can be used to parse the contents of this field in Python:

  • for length analysis, or analysis of raw alignments:


    snipped for Pandas:

    import pandas as pd
    data = pd.read_table("exported.txt", low_memory=False)
    data = pd.concat([data, d.refPoints.str.extract(anchorPointsRegex, expand=True).apply(pd.to_numeric)], axis=1)
  • A simplified regular expression with a smaller number of fields can be used for analysis of CDR3-assembled clonotypes:


    snipped for Pandas:

    import pandas as pd
    data = pd.read_table("exported.txt", low_memory=False)
    data = pd.concat([data, d.refPoints.str.extract(anchorPointsRegex, expand=True).apply(pd.to_numeric)], axis=1)


Export only the best V, D, J hits and the best V hit alignment from a .vdjca file:

mixcr exportAlignments -vHit -dHit -jHit -vAlignment input.vdjca test.txt
Best V hit Best D hit Best J hit Best V alignment
IGHV4-34*00   IGHJ4*00 |262|452|453|47|237|SC268GSC271ASC275G|956.1,58|303|450| 56|301|SG72TSA73CSG136TSA144CSA158CSG171T|331.0|
IGHV2-23*00 IGHD2*21 IGHJ6*00 |262|452|453|47|237|SC268GSC271ASC275G|956.1,58|303|450| 56|301|SG72TSA73CSG136TSA144CSA158CSG171T|331.0|

The syntax of alignment is described in appendix.

Exporting well formatted alignments for manual inspection

MiXCR is able to export alignments create with the align step as pretty formatted text (human readable) for manual analysis. This can be used both to inspect alignments and to facilitate optimization of analysis parameters and library preparation protocol. To export pretty formatted alignments use the exportAlignmentsPretty command:

mixcr exportAlignmentsPretty --skip 1000 --limit 10 input.vdjca test.txt

this will export 10 results after skipping the first 1000 records, then place the results into the file test.txt. Skipping earlier records is often useful because the first sequences in a fastq file may have lower than average read quality. Omitting the last parameter (output file name) will print results directly to the standard output stream (to console), like this:

mixcr exportAlignmentsPretty --skip 1000 --limit 10 input.vdjca

Here is a summary of the command line options:

Option Description
-n, --limit limit number of alignments; no more than provided number of results will be outputted
-s, --skip number of results to skip
-t, --top output only top hits for V, D, J nad C genes
--cdr3-contains output only those alignments in which CDR3 contains specified nucleotides (e.g. --cdr3-contains TTCAGAGGAGC)
--read-contains output only those alignments for which the corresonding reads contain specified nucleotides e.g. --read-contains ATGCTTGCGCGCT)
--verbose use a more verbose format for alignments (see below for example)

Results produced by this command have the following structure:

  >>> Read id: 1

   Quality    88888888888888888888888887888888888888888888888888888888888888888888888887888878
IGHV3-7*00 54 aaggcctttccacttggtgatcagcactgagcacagaggactcaccatggaAttggggctgagctgggttttccttgttg 133

                        L1><L2     L2><FR1
   Quality     88888888887888888888888888888889989989989889999997999999989999999999999999999899
IGHV3-7*00 134 ctattttagaaggtgtccagtgtgaggtgCagCtggtggagtctgggggaggcTtggtccagcctggggggtccctgaga 213

                             FR1><CDR1              CDR1><FR2
   Quality     999999999999999999999999999999999999999999999 9999999999999999999999999999999999
IGHV3-7*00 214 ctctcctgtgCagcctcTggattcacctttagtagCtattggatgAgc-tgggtccgccaggCtccagggAaggggctgg 292

                         FR2><CDR2              CDR2><FR3
   Quality     99999999999999999999999999999999999799999999999999999999999999998999899898999999
IGHV3-7*00 293 aGtgggtggCcaacataaAgcAAgatggaagtgagaAAtACtaTGtggaCtctgtgaAgggCcgattcaCCatCtcCaga 372

    Quality     99899899999999988989999889979988888888878878788888888878888888778788888888878888
 IGHV3-7*00 373 gacaacgccaagaaCtcactGtatctgcaaatgAacagcctgagagCcgaggacacggcTgtGtattaCtgtgcga     448
IGHD3-10*00  12                                                                              ttc 14

    Quality     88888788888888888888888787788777887787777877777877787787877878788788777767778788
IGHD3-10*00  15 gg-ggag                                                                          20
   IGHJ4*00   8              gactactggggccagggaAccctggtcaccgtctcctc                              45
   IGHG4*00   0                                                      cttccaccaagggcccatcggtcttcc 26
   IGHG3*00   0                                                      cttccaccaagggcccatcggtcttcc 26
   IGHG2*00   0                                                      cCtccaccaagggcccatcggtcttcc 26
   IGHG1*00   0                                                      cCtccaccaagggcccatcggtcttcc 26
   IGHGP*00 194                                                    AgcCtccaccaagggcccatcggtcttcc 222

 Quality     87370
 Target0 479 CCTTG 483
IGHG4*00  27 ccCtg 31
IGHG3*00  27 ccCtg 31
IGHG2*00  27 ccCtg 31
IGHG1*00  27 ccCtg 31
IGHGP*00 223 ccCtg 227

Usage of the --verbose option will produce alignments in a slightly different format:

>>> Read id: 12343    <--- Index of analysed read in input file

>>> Target sequences (input sequences):

Sequence0:   <--- Read 1 from paired-end read
Contains features: CDR1, VRegionTrimmed, L2, L, Intron, VLIntronL, FR1, Exon1,              <--- Gene features
VExon2Trimmed                                                                                    found in read 1




Sequence1:   <--- Read 2 from paired-end read
Contains features: JCDR3Part, DCDR3Part, DJJunction, CDR2, JRegionTrimmed, CDR3, VDJunction,
VJJunction, VCDR3Part, ShortCDR3, FR4, FR3





>>> Gene features that can be extracted from this (paired-)read:                         <--- For paired-end reads
JCDR3Part, CDR1, VRegionTrimmed, L2, DCDR3Part, VDJTranscriptWithout5UTR, Exon2, L,           some gene features
DJJunction, Intron, FR2, CDR2, VDJRegion, JRegionTrimmed, CDR3, VDJunction, VJJunction,       can be extracted by
VLIntronL, FR1, VCDR3Part, ShortCDR3, Exon1, FR4, VExon2Trimmed, FR3                          merging sequence

>>> Alignments with V gene:

IGHV3-33*00 (total score = 1638.0) <--- Alignment of both reads with IGHV3-33
Alignment of Sequence0 (score = 899.0):   <--- Alignment of IGHV3-33 with read 1 from paired-end read
        ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||
        DG8F78CFC6CEFF<,CFG9EED,6,CFCC<EEGFG,CE:CCAFFGGC87CEF?A?FBC@FGGFG>B,FC9F9,A,95AF     <--- Quality score

        |||||||||||||||||||||||||||||||||||||| |||||| ||||||||||| ||||| ||||||||||||||||

        |||||| |||| || | ||| | |||||||||  || |||||| ||||||||| ||||| | ||||||||| |||||
        2A:ECE5EC5**2@ C+:++++++22*2:+29+*2***25/79*0299))*/)*0*0*.75)7:)1)1/))))9:.)

Alignment of Sequence1 (score = 739.0):   <--- Alignment of IGHV3-33 with read 2 from paired-end read
        ||||||| |||||| ||||||||| ||||||||||||| ||||||||||||| ||||||||||| |||||||||||||||

        |||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||


IGHV3-30*00 (total score = 1582.0)  <--- Alternative hit for V gene
Alignment of Sequence0 (score = 885.0):
        ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||

        |||||||||||||||||||||||||||||||||||||| |||||| ||||||||||| ||||| ||||||||||||||||

        ||| || |||| || | ||| | |||||||||  || |||||| ||||||||| ||||| | ||||||||| |||||
        2A:ECE5EC5**2@ C+:++++++22*2:+29+*2***25/79*0299))*/)*0*0*.75)7:)1)1/))))9:.)

Alignment of Sequence1 (score = 697.0):
        ||||||| |||||| ||||||||| |||||||  |||| ||||||||||||| ||||||||||| |||||||||||||||

        |||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |||||


>>> Alignments with D gene:

IGHD4-17*00 (total score = 40.0)
Alignment of Sequence1 (score = 40.0):
      7 GGTGACTA 14
    183 GGTGACTA 190

IGHD4-23*00 (total score = 36.0)
Alignment of Sequence1 (score = 36.0):
      0 TGACTACGGT 9
        || |||||||
    191 TGTCTACGGT 200

IGHD2-21*00 (total score = 35.0)
Alignment of Sequence1 (score = 35.0):
     13 GGTGACT 19
    183 GGTGACT 189

>>> Alignments with J gene:

IGHJ6*00 (total score = 172.0)
Alignment of Sequence1 (score = 172.0):
        ||||||| ||||| ||||||||||||||||||||||||||

>>> Alignments with C gene:

No hits.

Exporting reads aggregated by clones

MiXCR allows to preserve information about mapping between initial reads, alignments and final clonotypes by storing output of the assemble step into special “clones & alignments” container format. There are several ways of accessing this information.

Extracting reads for specific clones

The exportReadsForClones allows to extract original reads that was mapped to specific clones back into fastq or fasta formats.

The following command will create reads_cln0_R1.fastq.gz/reads_cln0_R2.fastq.gz, reads_cln1_R1.fastq.gz/reads_cln1_R2.fastq.gz, etc, containing reads corresponding to clone0, clone1 etc…

mixcr exportReadsForClones -s clonesAndAlignments.clna reads.fastq.gz

Or one can extract reads for a buch of clones into a single output:

mixcr exportReadsForClones --id 2 12 45 clonesAndAlignments.clna reads_of_my_clones.fastq.gz

See mixcr help exportReadsForClones for more information.